Extension:DNASeq

From MediaWiki.org
Jump to: navigation, search
MediaWiki extensions manual - list
Crystal Clear action run.png
DNASeq

Release status: stable

Implementation Tag
Description Displays a DNA Sequence
Author(s) Pierre Lindenbaum
Last version 1.0 (2009-01-04)
MediaWiki Tested on 1.13.3
License No license specified
Download see below
Check usage and version matrix

This Mediawiki extension enables you to display a DNA Sequence.

Contents

Screenshot [edit]

DNASeq Extention Tag.jpeg

Usage [edit]

<dnaseq>ATGACTGACAC ACTGATAGCTACGATCtagctagca N Y N N N tgctacgatgctagcatgctagctgac</dnaseq>

Source [edit]

The source is available here: http://code.google.com/p/lindenb/source/browse/trunk/proj/mediawiki/extensions/dnaseq/dnaseq.php

another version , proposed by Niklas Laxström

Installation [edit]

Add...

require_once("$IP/extensions/dnaseq/dnaseq.php");

...to your LocalSettings.php file.

and copy the source to $IP/extensions/dnaseq/dnaseq.php

Reference [edit]

To Do [edit]

CSS, base indexing, sending to blast...