Extension:DNASeq
From MediaWiki.org
 Release status: stable |
|
|---|---|
| Implementation | Tag |
| Description | Displays a DNA Sequence |
| Author(s) | Pierre Lindenbaum |
| Last version | 1.0 (2009-01-04) |
| MediaWiki | Tested on 1.13.3 |
| License | No license specified |
| Download | see below |
|
Check usage (experimental) |
|
This Mediawiki extension enables you to display a DNA Sequence.
Contents |
[edit] Screenshot
[edit] Usage
<dnaseq>ATGACTGACAC ACTGATAGCTACGATCtagctagca N Y N N N tgctacgatgctagcatgctagctgac</dnaseq>
[edit] Source
The source is available here: http://code.google.com/p/lindenb/source/browse/trunk/proj/mediawiki/extensions/dnaseq/dnaseq.php
another version , proposed by Niklas Laxström
[edit] Installation
Add...
require_once("$IP/extensions/dnaseq/dnaseq.php");
...to your LocalSettings.php file.
and copy the source to $IP/extensions/dnaseq/dnaseq.php
[edit] Reference
- An extension for MediaWiki: displaying a DNA sequence. My blog post.
[edit] To Do
CSS, base indexing, sending to blast...
