
From MediaWiki.org
Jump to navigation Jump to search
MediaWiki extensions manualManual:Extensions
Crystal Clear action run.svg

Release status:Extension status stable

ImplementationTemplate:Extension#type Tag
DescriptionTemplate:Extension#description Displays a DNA Sequence
Author(s)Template:Extension#username Pierre Lindenbaum
Latest versionTemplate:Extension#version 1.0 (2009-01-04)
MediaWikiTemplate:Extension#mediawiki Tested on 1.13.3
LicenseTemplate:Extension#license No license specified
Download see below

Translate the DNASeq extension if it is available at translatewiki.net

Check usage and version matrix.

This Mediawiki extension enables you to display a DNA Sequence.


DNASeq Extention Tag.jpeg


<dnaseq>ATGACTGACAC ACTGATAGCTACGATCtagctagca N Y N N N tgctacgatgctagcatgctagctgac</dnaseq>


The source is available here: http://code.google.com/p/lindenb/source/browse/trunk/proj/mediawiki/extensions/dnaseq/dnaseq.php

another version , proposed by Niklas Laxström




...to your LocalSettings.php file.

and copy the source to $IP/extensions/dnaseq/dnaseq.php


To Do[edit]

CSS, base indexing, sending to blast...