Extension:DNASeq

From MediaWiki.org
Jump to navigation Jump to search
MediaWiki extensions manual
OOjs UI icon advanced.svg
DNASeq
Release status: stable
Implementation Tag
Description Displays a DNA Sequence
Author(s) Pierre Lindenbaum
Latest version 1.0 (2009-01-04)
MediaWiki Tested on 1.13.3
License No license specified
Download see below
Translate the DNASeq extension if it is available at translatewiki.net
Check usage and version matrix.

This Mediawiki extension enables you to display a DNA Sequence.

Screenshot[edit]

DNASeq Extention Tag.jpeg

Usage[edit]

<dnaseq>ATGACTGACAC ACTGATAGCTACGATCtagctagca N Y N N N tgctacgatgctagcatgctagctgac</dnaseq>

Source[edit]

The source is available here: https://code.google.com/p/lindenb/source/browse/trunk/proj/mediawiki/extensions/dnaseq/dnaseq.php

another version , proposed by Niklas Laxström

Installation[edit]

Add...

require_once("$IP/extensions/dnaseq/dnaseq.php");

...to your LocalSettings.php file.

and copy the source to $IP/extensions/dnaseq/dnaseq.php

Reference[edit]

To Do[edit]

CSS, base indexing, sending to blast...